Serotonin (5-hydroxytryptamine, 5-HT) is a neurotransmitter with diverse central and peripheral actions mediated by a large family of plasma membrane receptors. The serotonin transporter (SERT) is a specific transporter protein that terminates the serotoninergic activity by rapid re-uptake of 5-HT into the cells. The expression and the activity of SERT have been described in the central and enteric nervous system (1, 2) and in specialised non-neuronal cells including platelets (3), placental syncytiotrophoblasts (4) and epithelial cells of the gastrointestinal mucosa (5, 6, 7). The alteration of the serotoninergic activity has been shown to be involved in many pathological processes, especially in neuropsychiatric disorders, such as depression and mood disorders (8, 9), the intestinal pathogenesis of irritable bowel syndrome (IBS) (10, 11) and intestinal inflammation (12, 13). Consequently, SERT has become an interesting molecular target for multiple therapeutic compounds that modulate the 5-HT availability by inhibiting the SERT activity.

The interest in the determination of both the molecular characteristics and the regulation of human SERT (hSERT) has been enormous over the course of the last decade, but the difficulty in obtaining human tissues and the ethical limitations in human experiments have obliged researchers to look for alternative models. Most of the hSERT molecular studies have been carried out using hSERT heterologously expressed in human cell lines (14-17) and, to a lesser extent, in cells that express the SERT such as JAR, human placental cells, (18, 19) or platelets (3, 20).

5-HT is mainly produced by the enterochromaffin cells of the gastrointestinal tract, so the enterocytes of the intestinal epithelium may play an important role in the modulation of 5-HT availability and, consequently, in its intestinal effects. In culture, and after confluence, the human enterocyte-like Caco-2 cell line expresses similar morphological characteristics, as well as most of the functional properties of differentiated small intestine enterocytes (21), and this cell line has been used as an "in vitro" model to study several intestinal epithelial processes. Furthermore, recent results have demonstrated 5-HT transport in Caco-2 cells (22, 23), although the molecular characteristics and the regulation of this transport are not known.

In this work we have studied the hSERT expression in Caco-2 cells, the molecular characteristics (mRNA and protein) and the hSERT regulation mediated by short and long-term action of either protein kinase C (PKC) or cAMP. The results obtained have demonstrated the native expression of hSERT in the human enterocyte-like Caco-2 cell line. This fact, together with the special characteristics of the culture of Caco-2 cells (e.g. a long time culture, conserving the same morphological, molecular and functional properties), indicate that Caco-2 cells may be an excellent "in vitro" model to study the hSERT function and regulation.


MATERIALS AND METHODS
Cell culture. Caco-2/TC7 cells were kindly provided by Dr. Edith Brot-Laroche (U-505 INSERM). The cells were cultured at 37°C in an atmosphere of 5% CO2 and were kept in high glucose DMEM supplemented with 2 mM glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin, 1% non-essential amino acids and 20% foetal bovine serum (Invitrogen, USA). The cells were passaged enzymatically (0.25% trypsin- 1mM EDTA) and sub-cultured in 25 or 75 cm2 plastic culture flasks (Sarstedt, Germany). The medium was changed 48 hours after seeding and daily thereafter. The cells were always used between passages 19 and 40. For 5-HT uptake assays, cells were seeded in 24-well plates at a density of 4x104cells/well, and most of the uptake measurements were carried out 14 days after seeding (9 days after confluence). In the study of the 5-HT uptake at different degrees of cell differentiation, the cells were used at the following conditions: Preconfluence (four days after seeding) and 0, 2, 5, 10 and 12 days post-confluence. In studies of regulation, the cells were treated with the PKC activator phorbol myristate acetate (PMA) and the cell permeable cAMP analog dibutyryl cAMP (d-cAMP), by addition to the culture medium at different times before the uptake determination. In most of the uptake experiments, the cell medium was free of foetal bovine serum 6 h before the transport measurement.

RT-PCR, cDNA cloning and sequencing. Total RNA was extracted and purified from Caco-2 cell cultures with the QuickPrep Total RNA extraction kit, according to the manufacturer's instructions (Amersham Biosciences, UK). The extracted RNA was then used as a template for first-strand cDNA synthesis using oligo(dT) primers and a modified M-MLV Reverse Transcriptase (Invitrogen). Negative amplification control was performed in the absence of Reverse Transcriptase. One tenth of the resultant cDNA was used for PCR amplification. Specific oligonucleotide primers for hSERT (18) (Genbank accession NM_001045) were designed to amplify the full-length coding sequence: Primer sequences (5'-3'), sense AAATCCAAGCACCCAGAGAT and anti-sense AGACTGTGTCCCTGTGGAGA were used to obtain a PCR product of 2105 bp, which encodes the full open reading frame. Thirty cycles of PCR amplification were carried out as follows: 94°C for 30 s, 56°C for 30 s and 68°C for 2 min 30 s. The size of the PCR product was confirmed by electrophoresing in a 1% agarose gel.

The cDNA was purified with StrataPrep PCR Purification kit (Stratagene, La Jolla, Ca, USA) and cloned into pPCR-Script Amp SK(+) vector (PCR-Script Amp Cloning Kit, Stratagene). Sequencing was automatically performed with AbiPrism 377 (PerkinElmer Life Sciences Inc., Boston, MA, USA).

Caco-2 biotinylation and purification of cell surface proteins. Protein biotinylation was carried out with a Cell Surface Protein Biotinylation and Purification kit (Pierce, Rockford, USA) according to the manufacturer's instructions. Caco-2 cells seeded in 75 cm2 flasks were washed with ice-cold-PBS and incubated with Sulfo-NHS-SS-Biotin for 1 hour at 4°C. After quenching, the cells were scraped and centrifuged at 500g for 3 minutes. The pellet was re-suspended with lysis buffer and the cells were disrupted by sonication (five 1 second bursts, 60W). One sample was taken from the lysate for protein analysis measured by the Bradford method (Bio-rad) using bovine serum albumin as standard. The cell lysate was centrifuged at 15000g for 10 minutes. The supernatant was added to a column with immobilized neutravidin gel and, after incubation for 1 hour, the mixture was centrifuged at 1000g for 1 minute and the flow-through was discarded. The column was washed with washing buffer and centrifuged at 1000g for 1 minute three times. Finally, SDS-PAGE sample buffer with 50 mM DTT was added to the gel in the column, and the reaction was incubated for 1 hour. The column was centrifuged for 2 minutes at 1000g and the flow-through was used for Western blotting analysis.

Western blotting. Purified cell surface protein samples and Caco-2 cell lysate (60 µg) were electrophoresed in 9% SDS-PAGE gels then transferred to PVDF membranes by electroblotting. The blots were blocked with 5% non-fat dried milk plus 1% BSA, and probed with a rabbit polyclonal anti-rat SERT 1:5000 (AB1594, Chemicon, Temecula, Ca, USA). The primary antibody was detected using a secondary donkey anti-rabbit Ig coupled to horseradish peroxidase (Santa Cruz Biotechnologies, Ca, USA) and the ECL plus detection system (Amersham). The signal was visualized with X-ray films (Hyperfilm MP, Amersham).

5-HT uptake studies. Uptake measurements were performed on cells attached to 24-well plates. The transport medium contained in mM: 137 NaCl, 4.7 KCl, 1.2 KH2PO4, 1.2 MgSO2, 2.5 CaCl2, 10 HEPES pH 7.4, 4 glutamine, 0.1% bovine serum albumin and both 5-HT and [3H]-5-HT (specific activity 11.6 Ci/mmol, Amersham). In the Na+-free medium, NaCl was replaced isosmotically by choline chloride (CholCl). Before the uptake measurement, the cells were pre-incubated at 37°C in an atmosphere of 5% CO2 with substrate-free transport medium (without 5-HT) for 30 min. The cells were then immediately washed twice with substrate-free transport medium at 37°, and incubated with transport medium at 37°C for 6 minutes. At the end of the incubation period, the medium was removed and the cells were washed twice with ice-cold substrate-free transport medium containing 5-HT 1 mM. The cells were lysed in 0.1 M NaOH and counted for radioactivity and protein content. The radioactivity values of the samples were transformed into pmol/mg protein.

Statistical analysis. All results are expressed as means ± SEM. Statistical comparisons were performed using one-way ANOVA followed by a Dunnet post-test with a confident interval of the 99% (P<0.01). Kinetic analysis of the 5-HT transport values was performed by non-linear regression, fitting the results to an equation containing a saturable component (Michaelis-Menten). The statistical analysis, the fluoxetine IC50 and the 5-HT transport kinetic constants were calculated with the computer-assisted Prism GraphPad Program (Prism version 2.0 for iMac computer).


RESULTS
SERT mRNA and protein identification in Caco-2 cells. A product of 2105 bp of length was amplified by RT-PCR from RNA of differentiated Caco-2 cells (Fig. 1) as described in Materials and Methods. This PCR product was cloned and sequenced (GenBank accession number AY902473). The nucleotide sequence of the amplified cDNA was compared with the BLAST database, confirming that it is identical to the human brain Na/Cl-dependent SERT.

Fig. 1. hSERT mRNA expression in Caco-2 cells. RT-PCR analysis was performed with RNA from Caco-2 cells using specific primers for human SERT, as described in Materials and Methods. PCR product (2105 bp) was electrophoresed in an agarose gel and visualised with ethidium bromide.

The SERT protein was analysed by Western blotting after biotinylation and purification of the Caco-2 surface proteins. This analysis has shown that both the cellular lysate (total protein) and the purified protein fraction of Caco-2 cells express a protein immunodetected by a specific primary antibody anti-rat SERT, which reacts with hSERT (Fig. 2, lines 3 and 4). The molecular size of the immunodetected protein in Caco-2 cells, about 70 kDa, was similar to the SERT size detected in rat intestinal mucosa and brain, used as SERT control in the same experiment (Fig 2, lines 1 and 2, respectively).

Fig. 2. Western blotting analysis of SERT protein in Caco-2 cells. SERT immunodetection in purified cell surface protein samples and Caco-2 cell lysate (60 µg) (lines 3 and 4, respectively), compared with rat intestinal mucosa (line 1) and rat brain synaptosomes (line 2) as control.

Study of the 5-HT uptake as a function of Caco-2 cell differentiation. After identification of the mRNA and the protein, the aim of the experiments was to determine the SERT functionality and its relationship with the degree of cell growth and differentiation of Caco-2 cells. The results (Fig. 3) show that Caco-2 cells uptake 5-HT early in the time culture, even before confluence. The 5-HT uptake increased with the level of differentiation and it seemed to reach a plateau at the fifth post-confluence day. This transport was specific and was significantly inhibited by 5-HT, imipramine and fluoxetine at any degree of cellular differentiation. In the absence of Na+, the 5-HT transport was significantly reduced (Fig. 3). These results indicate that the 5-HT uptake in Caco-2 cells may be carried out by SERT and that its expression is dependent on the differentiation status of the cells.

Fig. 3. 5-HT uptake measured at different degrees of cell differentiation according to the pre-cellular and post-cellular confluence culture time. The cellular conditions were: Preconfluence (fourth day after seeding) and 0, 2, 5, 10 and 12 days post-confluence. The 5-HT concentration was 0.2 µM. The experimental conditions were: C = Control; 5-HT = 5-HT 20 µM; I = Imipramine 1 mM; F= Fluoxetine 1 µM; C (Chol) = Na+ was replaced by choline. The data are the mean ± SEM of 6 experiments. * P<0.01 compared with control conditions.

Kinetic study of the 5-HT uptake. Inhibition by fluoxetine. The kinetic constants Vmax and Kt of the 5-HT uptake were calculated in order to corroborate that the 5-HT transport in the Caco-2 was mediated by SERT. The 5-HT uptake was measured at different 5-HT concentrations (0.05-50 µM) under either control conditions or in the absence of Na+. The kinetic constants obtained were: Vmax = 12.05±0.95 pmol/ mg prot and Kt = 0.216±0.049 µM.

The inhibition specificity of the 5-HT transporter in Caco-2 cells was determined by studying the inhibition profile of fluoxetine, a selective 5-HT re-uptake inhibitor. The fluoxetine inhibition of the 5-HT uptake was strong and concentration-dependent, and the IC50 value calculated was 17.6 nM.

Effect of PKC and cAMP on 5-HT transport mediated by SERT. The aim of this group of experiments has been to characterize the SERT regulation in Caco-2 cells mediated by both PKC and cAMP, either after short- (30 min) or long- (24 or 48 h) term treatments. To study the PKC regulation of SERT, PMA, an activator of PKC, was assayed. The results show that PMA 1 µM induced an inhibition of the 5-HT uptake after 30 min of cell treatment. This effect increased with the period of treatment (24 or 48 h) and was PMA concentration-dependent (Fig. 4A). The kinetic study of the SERT activity after 48 h treatment of the cells with different PMA concentrations (0.2, 0.5 and 1 µM) was determined (Fig 4B) and the kinetic constants Vmax and Kt calculated (Tab. 1). The results show that the treatment with PMA reduced the 5-HT transport, by affecting mainly the Vmax.

Fig. 4. Regulation of the 5-HT uptake mediated by PMA in Caco-2 cells. A. The effect of PMA (1 mM) was determined and related to the period of the treatment (left) or to the PMA concentration after treating the cells during 24 h (right). 5-HT concentration assayed was 0.2 µM. C = Control condition in which the cells were not treated. The results are expressed as the mean ± SEM (7 experiments) of the % of the 5-HT uptake compared with the value of 5-HT uptake control (100%). * P<0.01 compared with the control. B. Kinetic study of SERT activity after long-term treatment of Caco-2 cells with PMA. The cells were treated during 24h with three PMA concentrations: 0.2, 0.5 and 1 µM. 5-HT concentration range was 0.05-5 µM. The results are the mean of 5 experiments.

Table 1. Kinetic study of the 5-HT uptake after 48 h treatment of the Caco-2 cells with different PMA concentrations. The kinetic constants Vmax and Kt were calculated from the results of 5 independent experiments. The results are the mean±SEM.

The cAMP effect on the SERT function was studied by using d-cAMP, a cell permeable cAMP analog. The results show that d-cAMP significantly diminished the 5-HT uptake in Caco-2 cells and this inhibition increased with the period of cell treatment (Fig 5A). Similar effects were obtained with forskolin, an adenylate cyclase activator (data not shown). The effect of 48 h of treatment with d-cAMP (0.5 and 1 mM) on SERT activity was also determined by measuring the transport of 5-HT at different concentrations (0.05-10 µM) (Fig 5B). The kinetic constants Vmax and Kt were calculated (Tab. 2), and the results show that d-cAMP seems mainly to affect the Vmax.

Fig. 5. Effect of cAMP on the 5-HT uptake in Caco-2 cells. A. 5-HT concentration was 0.2 µM. The experiments were carried out at different treatment periods, and two concentrations of d-cAMP (0.5 and 1 mM) were assayed. C = Control condition in which the cells were not treated. The results are expressed as the % of the control (100%) and are the mean ± SEM of 7 experiments. * P<0.01 compared with the control. B. Kinetic study of SERT activity after long-term treatment of Caco-2 cells with d-cAMP. The cells were treated during 48 h with two d-cAMP concentrations: 0.5 and 1 mM. The 5-HT range concentration was 0.05-10 µM. The uptake conditions are described in Materials and Methods. The results are the mean of 6 experiments.

Table 2. Kinetic study of the 5-HT uptake in Caco 2 cells treated during 48 h with different concentrations of d-cAMP. The kinetic constants were calculated from the results obtained in 5 independent experiments. The results are the mean±SEM.

DISCUSSION
SERT, that was firstly described and cloned in 1991 (24, 25), uptakes 5-HT from the extracellular space, and modulates both the 5-HT availability and the 5-HT response.

The alteration of the serotoninergic activity has been considered as a determining factor in the genesis of several neuropsychiatric and intestinal pathologies, and the hSERT has been described as a pharmacological target in the treatment of these disorders. Since the main problem in human physiological research is the availability of human biological samples, many SERT studies have been carried out by using heterologous systems that replace the human tissue (15-17, 26, 27), and by using cellular models (3, 18-20).

Recent results (22, 23) have shown that the human enterocyte-like Caco-2 cells uptake 5-HT by a specific system of transport. Since the molecular characterization and the intracellular regulation of this transport system in Caco-2 cells are yet to be determined, the aim of this present work has been to offer an in-depth characterization of SERT in order to validate this cell line as a possible "in vitro" model to study the hSERT.

The results obtained corroborate the assertion that the 5-HT uptake in Caco-2 cells is carried out by a specific Na+-dependent transport system with a Kt similar to the value described in previous studies (7, 18). In addition, this transport was potently inhibited by fluoxetine and the IC50 value (17.6 nM) was also similar to that obtained by other authors (23). These functional characteristics indicate that the earlier-described neuronal SERT may carry out the 5-HT uptake in Caco-2 cells.

Previous RT-PCR analysis of the SERT expression in Caco-2 cells has demonstrated the amplification of a 319 bp product that may correspond to the SERT mRNA (23). In order to demonstrate this point, we amplified and sequenced the complete coding sequence of SERT in Caco-2 cells (2105 bp) and we found that this sequence was identical to the human neuronal Na/Cl dependent SERT. Furthermore, using a specific antibody, we detected a protein of about 70 kDa, in both the cell lysate and the protein surface enriched-fraction of Caco-2 cells. The molecular size of the detected protein was similar to that described in cells transfected with the cDNA encoding the human brain SERT (14). A second band of about 40 kDa was detected in rat intestinal mucosa and brain. The detection of 37 kDa SERT-immunoreactive protein band has been recently described in rat brain by Dmitriev et al (28) who concluded that it might be the result of site-specific SERT endoproteolytic cleavage. To the best of our knowledge, these results demonstrate for the first time, the expression of the hSERT in Caco-2 cells.

To characterize the SERT function in Caco-2 cells in greater detail, we also studied the 5-HT transport as a function of the different degree of cell growth and differentiation. The results demonstrated that 5-HT uptake is detected in Caco-2 cells before the confluence is reached, and that the 5-HT transport increased with the level of differentiation until reaching a plateau at day 5 after confluence. This 5-HT transport level was maintained in Caco-2 cells during 12 days after confluence, indicating that the Caco-2 cell line may be a suitable "in vitro" model to study SERT long-term (days) regulation by treatment with different substances.

Finally, we have also determined both the short and long-term regulation of the hSERT in Caco-2 cells mediated by PKC and cAMP. The results obtained show that the 5-HT uptake was significantly inhibited by PMA after both short and long-term treatment of the cells, and the inhibition of the SERT activity increased with the PMA concentration. In addition, the effect of the long-term PKC stimulation has been shown to mainly affect the capacity (Vmax) of SERT. These results corroborate the results obtained by other authors on native tissues and transfected cells (15, 16, 20, 27, 29), who concluded that the short-term action of PKC induced the SERT phosphorylation and sequestration, modifying the SERT distribution and density in the membrane, and diminishing the uptake capacity. Recent results have also suggested that short-term changes in intracellular calcium levels mediated by hormones may be responsible for the inhibition of SERT activity (30). It is important to note, however, that we have also demonstrated that the PKC effect on SERT capacity (reduction of Vmax) continues after the long-term action of PKC on the cells.

The effects of cAMP on SERT activity have been more controversial. Although SERT phosphorylation in heterologous systems was triggered by cAMP analogs, little or no functional effect was obtained on SERT activity following PKA triggered phosphorylation (31). In order to clarify the effect of cAMP on SERT activity in a native cellular context, we measured the SERT activity in Caco-2 cells after either short (minutes) or long (24 or 48 h) term action of the cAMP analog d-cAMP. The results demonstrated that 5-HT uptake was inhibited by increasing the intracellular cAMP level, either in short or long-term treatment. This inhibition was time and dose-dependent and was smaller than the 5-HT uptake inhibition detected with PMA. The kinetic study of the SERT activity after long-term d-cAMP treatment (48h) of Caco-2 cells showed a reduction of SERT capacity (Vmax). These results differ from those obtained by other authors; Ramamoorthy et al. (15) indicated that although forskolin increased SERT phosphorylation, it failed to reduce 5-HT uptake, while the results of Morikawa et al. (26) concluded that d-cAMP induced an increase in both the level of SERT mRNA and the uptake activity after 3 h of treatment in BeWo cells (human choriocarcinoma cells), which constitutively express SERT. The differences in these results corroborate the difficulties that are encountered when studying SERT regulation mediated by cAMP and may be due, in part, to the heterologous context of SERT expression and the different origin of the "in vitro" cellular models used for this purpose.

In conclusion, the results obtained in this work have demonstrated the expression characteristics of hSERT in the Caco-2 cells, as well as its function and regulation mediated by intracellular messengers such as PKC and cAMP. On the basis of these results it can be concluded that this cell line may be a suitable tool to study the role of the hSERT in several physiological and pathological processes, as well as its pharmacological modulation.

Acknowledgements: This work has been supported by a grant from the Spanish Ministry of Science and Technology and the European Regional Development Fund (ERDF/FEDER) (BFI 2003-01541), as well as by a grant from the Government of Aragon (Ref B41 2004).


REFERENCES

1. Rudnick G, Clark L. From the synapse to vesicle: the reuptake and storage of biogenic amine neurotransmitters. Biochim. Biophys. Acta 1993; 1144: 249-263.
2. Chen JJ, Li Z, Pan H, Murphy DL, Tamir H, Koepsell H, Gershon MD. Maintenance of serotonin in the intestinal mucosa and ganglia of mice that lack the high affinity serotonin transporter: Abnormal intestinal motility and the expression of cation transporters. J. Neurosci 2001; 21: 6348-6361.
3. Lesch KP, Wolozin BL, Murphy DL, Riederer P. Primary structure of the human platelet serotonin uptake site: Identity with the brain serotonin transporter. J. Neurochem 1993; 60: 2319-2322.
4. Balkovetz DF, Tiruppathi C, Leibach FH, Mahesh VB, Ganapathy V. Evidence for an imipramine-sensitive serotonin transporter in human placental brush border membranes. J. Biol. Chem 1989; 264: 2195-2198.
5. Wade PR, Chen J, Jaffe B, Kassem IS, Blakely RD, Gershon, MD. Localization and function of a 5-HT transporter in crypt epithelia of the gastrointestinal tract. J. Neurosci 1996; 16: 2352-2364.
6. Gershon MD. Serotonin and gastrointestinal function. CRC Press, Boca Raton, FL 1995.
7. Chen J-X, Pan H, Rothman TP, Wade PR, Gershon MD. Guinea pig 5-HT transporter: cloning, expression, distribution and function in intestinal sensory reception. Am. J. Physiol 1998; 275: G433-G448.
8. Maes M, Meltzer HY. Psychopharmacology. The Fourth Generation of Progress. New York, Raven, 1995.
9. Purselle DC, Nemeroff CB. Serotonin transporter: A potential substrate in the biology of suicide. Neuropsychopharmacology 2003; 28: 613-619.
10. Camilleri M, Atasanova E, Carlson PJ, Ahmad U, Kim HJ, Viramontes BE, Mckinzie S, Urrutia R. Serotonin transporter polymorphism pharmacogenetics in diarrhoea-predominant irritable bowel syndrome. Gastroenterology 2002; 123: 425-432.
11. Coates MD, Mahoney CR, Linden DR, Sampson JE, Chen J, Blaszyk H, Crowell MD, Sharkey KA, Gershon MD, Mawe GM, Moses PL. Molecular defects in mucosal serotonin content and decreased serotonin reuptake transporter in ulcerative colitis and irritable bowel syndrome. Gastroenterology 2004; 126: 1657-1664.
12. Sharkey K, Mawe GM. Neuroinmune and epithelial interactions in intestinal inflammation. Curr. Opin. Pharmacol 2002; 2: 669-677.
13. O'Hara JR, Ho W, Linden DR, Mawe GM, Sharkey KA. Enteroendocrine cells and 5-HT availability are altered in mucosa of guinea pigs with TNBS ileitis. Am. J. Physiol 2004; 287: G998-G1007.
14. Qian Y, Melikian HE, Rye DB, Levey AI, Blakely RD. Identification and characterization of antidepressant-sensitive serotonin transporter proteins using site-specific antibodies. J. Neurosci 1995; 15: 1261-1274.
15. Ramamorthy S, Giovanetti E, Qian Y, Bakely RD. 1998. Phosphorylation and regulation of antidepressant-sensitive serotonin transporters. J. Biol. Chem 1998; 23: 2458-2466.
16. Ramamorthy S, Blakely RD. Phosphorylation and sequestration of serotonin transporters differentially modulated by psychostimulants. Science 1999; 285: 763-766.
17. Bryan-Lluka LJ, Papacostas MH, Paczkowski FA, Wanstall JC. Nitric oxide donors inhibit 5-hydroxytyiptamine (5-HT) uptake by the human 5-HT transporter. Br. J. Pharmacol 2004; 143: 63-70.
18. Ramamoorthy S, Bauman AL, Moore KR, Hong H, Yang-Feng TL, Chang AS, Ganapathy V, Blakely RD. Antidepressant and cocaine sensitive human serotonin transporter: Molecular cloning, expression and chromosomal localization. Proc. Natl. Acad. Sci. U.S.A 1993; 90: 2542-2546.
19. Martel F, Keating E. Uptake of 1-methyl-4-phenylpyridinium (MPP+) by the JAR human placental choriocarcinoma cell line: comparison with 5-hydroxytryptamine. Placenta 2003; 24: 361-369.
20. Jayanthi LD, Samuvel DJ, Blakely RD, Ramamoorthy S. Evidence for biphasic effects of protein kinase C on serotonin transporter function, endocytosis, and phosphorylation. Mol. Pharmacol 2005; 67: 2077-2087.
21. Rousset, M. The human colon carcinoma cell lines HT-29 and Caco-2; two in vitro models for the study of intestinal differentiation. Biochimie 1986; 68: 1035-1040.
22. Alcalde AI, Sorribas V. Caco-2 cells and 5-HT transport. J. Physiol. Biochem 2001; 57: 117.
23. Martel F, Monteiro R, Lemos C. Uptake of serotonin at the apical and basolateral membranes of human epithelial (Caco-2) cells occurs through the neuronal serotonin transporter. J. Pharm. Exp. Ther 2003; 306: 355-362.
24. Hoffman BJ, Mezey E, Brownstein J. Cloning of a serotonin transporter affected by antidepressants. Science 1991; 254: 579-580.
25. Blakely RD, Berson HE, Fremeau RT, Caron MG, Peek MM, Prince HK, Bradley CC. Cloning and expression of a functional serotonin transporter from rat brain. Nature 1991; 354: 66-70.
26. Morikawa O, Sakai N, Obara H, Saito N. Effects of interferon-alfa, interferon-gamma and cAMP on the transcriptional regulation of serotonin transporter. Eur. J. Pharmacol 1998; 349: 317-324.
27. Qian Y, Galli A, Ramamoorthy S, Risso S, DeFelice LJ, Blakely RD. Protein kinase C activation regulates human serotonin transporters in HEK-293 cells via altered cell surface expression. J. Neurosci 1997; 17: 45-57.
28. Dmitriev AD, Factor MI, Segal OL, Pavlova EV, Massino YS, Smirnova MB, Yakoleva DA, Dmitriev DA, Kizim EA, Kolyaskina GI, Brasov OS. Western blot analysis of human and rat serotonin transporter in platelets and brain using site-specific antibodies: Evidence that transporter undergoes endoproteolytic cleavage. Clin. Chim. Acta 2005; 356: 76-94.
29. Samuvel DJ, Jayanthi LD, Bhat NR, Ramamoorthy S. A role for p38 mitogen-activated protein kinase in the regulation of the serotonin transporter: evidence for distinct cellular mechanisms involved in transporter surface expression. J. Neurosci 2005; 25: 29-41.
30. Koldzic-Zivanovic N, Seitz PK, Watson ChS, Cinningham KA, Thomas ML. Intracellular signaling involved in estrogen regulation of serotonin uptake. Mol. Cel. Endocrinol 2004; 226: 33-42.
31. Blakely RD, Ramamoorthy S, Schroeter S, Qian Y, Apparsundaram S, Galli A, DeFelice LJ. Regulated phosphorylation and trafficking of antidepressant-sensitive serotonin transporter proteins. Biol. Psychiatry 1998; 44: 169-178.