PDE4 inhibitors increase cyclic adenosine monophosphate (cAMP) level in cells and inhibit various stages of the inflammatory process. cAMP is a classical second messenger synthesized from adenosine triphosphate (ATP) with the participation of a group of enzymes named adenylyl cyclases (1). It's involved in the regulation of levels of numerous hormones, cytokines and cell-mediated response to signals from neurotransmitters (2). cAMP is the main indicator for protein kinase A (PKA) - cAMP begins the cascade of reactions leading to changes in the cell function by modulating the activity of PKA (3). cAMP is decomposed to 5'nucleotidemonophosphoran by a specific phosphodiesterase (PDEs). The various isoforms of PDE4 are present in all mobile immune and structural cells of the respiratory tract (4-7). The clinical application of PDE4 inhibitors are limited by side effects of gastrointestinal nature (nausea, vomiting, diarrhea). Several multicenter clinical trials have been conducted on the treatment of non-infected airway inflammatory diseases using PDE4 inhibitors showing highly inconsistent results (8-11). Recently it has been shown that roflumilast can decrease the exacerbations of chronic obstructive pulmonary disease (COPD). Orally given roflumilast used alone improves FEV1 (forced expiratory volume in one second) by 48 mL (12), but it gives better results in combination with salmeterol - 49 ml, and tiotropium - 80 mL (13).
Eotaxins (eotaxin-1/CCL11, eotaxin-2/CCL24, eotaxin-3/CCL26) are the strongest chemotactic agents for eosinophils. They are small (74-93 aminoacids) cysteine-cysteine (CC) chemokines. Many lung structural cells such as epithelial cells, airway smooth muscle cells, vascular endothelial cells and fibroblasts produce eotaxins (14-18). Eotaxins are also synthesized by various mobile cells isolated by bronchial alveolar lavage (BAL) from the bronchoalveolar space: macrophages, monocytes, basophils, eosinophils and lymphocytes (19-22). All three eotaxins act through their specific CCR3 receptor present on eosinophils, macrophages, T lymphocytes, basophils and lung epithelial cells (23). The key players in eotaxin expression are: Th2 cytokines: interleukin-4 (IL-4) and interleukin-13 (IL-13) and tumor necrosis factor-a (TNF-
). Many authors suggest that eotaxins differ from each other in their biological role. They are secreted in the subsequent stages of the allergic reaction. Eotaxin-1 is expressed constitutively in both healthy and allergic patients. It is produced in early stages of the allergic response (24). Eotaxin-2 and eotaxin-3 seem to be responsible for the long lasting eosinophilia after late asthmatic response (LAR) (25). They are produced only after allergen stimulation. Berkman
et al. showed that only expression of eotaxin-3 24 hours after allergen challenge distinguishes asthmatics from healthy subjects. They reported up to 100-fold increase in eotaxin-3 mRNA in the lung biopsy from patients with asthma (26).
The effect of PDE4 inhibitors on key cells and their mediators which participate
in the pathogenesis of asthma or COPD has been shown by numerous reports. PDE4
inhibitors block the production of TNF-
,
IL-2, IL-5, IL-4, interferon g (INF-
),
prostaglandin 2 (PGE
2), many neutrophilic enzymes
and proliferation of T lymphocytes (27, 28). It was shown that PDE4 inhibitors
are the most effective in the reduction of inflammatory cell influx into lungs
and IL-4, IL-13, TNF-
levels in the bronchoalveolar fluid (BALf) compared with other PDEs inhibitors
(PDE1-isobutyl-methylxanthine, PDE3-cilostazol, PDE5-sildenafil, zaprinast,
theophiline-nonselective) (29, 30). PDE3 inhibitors are suppose to attenuate
the effect of PDE4 inhibitors (used in combination). PDE3 inhibitors can be
helpful in cough treatment (31) and as vasodilator in the vascular smooth muscle
environment with prolonged exposure to nitric oxide (NO) (32). Rolipram inhibits
eotaxin-1 secretion in smooth muscle cells stimulated with TNF-
(33). Sabatini
et al. showed that roflumilast N-oxide decrease eotaxin
release in TNF-
-treated human lung fibroblasts (34). Santamaria
et al. showed that rolipram
inhibits eotaxin-mediated activation and migration of eosinophils (35). Rolipram
also affects cell adhesion molecules that appear on eosinophils after eotaxin,
but not IL-5 action (36). PDE4 inhibitors selectively diminish the influx of
eosinophils into airways during experimental asthmatic reaction in an animal
model (37). Silva
et al. have shown that rolipram reduces the number
of eosinophils and concentration of eotaxin in the BALf of sensitized guinea
pigs after inhalation challenge with specific allergen (38).
The expression of eotaxins in stimulated human normal lung epithelial cells or established lung epithelial cell lines is well characterized (39-42). Also a decrease of eosinophils in airways during experimental asthmatic reaction in animals treated with PDE4 inhibitors is well documented. However direct effects of PDE4 inhibitors on eotaxin production by bronchial epithelial cells are not definitely established.
The aim of the presented study was to evaluate the effect of PDE4 inhibitors, rolipram and RO-20-1724 on eotaxin expression in human bronchial epithelial cells.
MATERIALS AND METHODS
Cell culture
Human bronchial epithelial cells BEAS-2B (American Type Culture Collection,
Rockville, MD, USA) were cultured in Airway Epithelial Cell Growth Medium (PromoCell,
USA, no. cat. C-21160) with 100 U/mL pencilin, 100 µg/mL streptomycin (PAA,
Austria) at 37°C in 5% CO
2. The experiments
were performed in Dulbecco's Modified Eagle's Medium (DMEM) without serum (Sigma
Aldrich, Germany).
Stimulation of the cells
When the cells reached 80% confluence they were preincubated with 10 µM rolipram (Sigma Aldrich, Germany), RO-20-1724 (Calbiochem, Germany) or dexamethasone (Sigma Aldrich, Germany). Compounds were dissolved in 96% ethanol. After 1 hour the cells were stimulated with IL-4, IL-13 (25 ng/mL) or TNF-
(10 ng/mL) purchased from R&D Systems ( Minneapolis, USA) for 48 hours. Cytokines were dissolved in water and minimal amount of bovine serum albumin (BSA).
ELISA
Culture supernatants were used to detect eotaxin-1, eotaxin-2 and eotaxin-3 using an ELISA from R&D Systems (USA) according to the manufacturer's instructions (cat. no. DTX00, DCC240B, DCC260B). The sensitivity of tests was: 5 pg/mL, 2.5 pg/mL, and 2.33 pg/mL for CCL11, CCL24 and CCL26 respectively. The optical density was read at 450 nm with correction at 570 nm on StarFax 2000 microplate reader (USA).
RNA extraction and determination of eotaxin gene expression level
Total RNA was isolated from cells using Trizol (Invitrogen, USA). The purity and concentration of isolated RNA was measured using 260/280 nm absorbance ratio at spectrophotometer (Beckman, USA) type DU650. One microgram of RNA was used for reverse transcription using quantitative SuperScript III First-Strand Synthesis SuperMix (Invitrogen, USA). Real-time quantitative PCR evaluation was performed with an ABI-Prism 7500 Sequence Detector System (Applied Biosystems, USA). For real-time PCR, 1 µl of cDNA was amplified in a 25 µl PCR volume containing Power SYBR Green PCR master mix (Applied Biosystems, USA) with 150 nmoles of specific primers. Each sample was measured in duplicate. The sequences of primers were as follows: Eotaxin-1: forward, 5'CTCGCTGGGCCAGCTTCTGTC3'; reverse, 5'GGCTTTGGAGTTGGAGATTTTTGG3' (227 bp). eotaxin-2: forward, 5'CACATCATCCCTACGGGCTCT3'; reverse, 5'GGTTGCCAGGATATCTCTGGACAGGG3' (288 bp). Eotaxin-3: forward, 5'GGAACTGCCACACGTGGGAGT
GAC3'; reverse, 5'CTCTGGGAGGAAACACCCTCTCC3' (354 bp) GAPDH: forward, 5'-GAAGGTGAAGGTCGGAGTC-3'; reverse, 5'-GAAGATGGTGATGGGATTTC-3' (226 bp).
For cDNA amplification, a 10-minute incubation at 95°C was performed to activate AmpliTaqGold DNA Polymerase followed by 45 cycles, each of 15 s and at 95°C and 1 min at 60°C. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control in order to normalize eotaxin-1, eotaxin-2 and eotaxin-3 expression levels. The results were expressed as relative quantification units (fold change).
Relative quantification values were calculated by the 2-
CT
method. The cycle thresholds (CT) for the target amplicon and for the endogenous
control (GAPDH) were determined for each sample. Differences were calculated
between these two CTs and called
CT,
in order to account for the differences in the amount of total nucleic acid
taken for each reaction. The value of
CT
for unstimulated cells (calibrator) was subtracted from the
CT
of each sample and termed
CT.
The value of the target normalized to the endogenous control for experimental
samples relative to that in the calibrator, was then calculated by the formula
2-
CT.
Statistical analysis
Data were analyzed using the Mann-Whitney
U-test. P-value <0.05 was considered
statistically significant.
RESULTS
Preliminary results
Our preliminary experiments were made to evaluate the optimal culture condition
for CCL26 production; because this chemokine respond to almost all cytokines
used, and has the highest expression in BEAS-2B cells. The results of the preliminary
trials are shown in
Fig. 1-3. IL-4 and IL-13 stimulated the CCL26 production
in dose dependent manner (
Fig. 1). CCL26 concentration peaked at 48 hour
after cytokine stimulation and the addition of TNF-
intensified this effect (
Fig. 2) also in dose dependent manner on protein
level (
Fig. 3).
|
Fig. 1. Effect of IL-13 and
IL-4 on CCL26 release by BEAS-2B at 48 h after stimulation. Cells were
treated with IL-13 or IL-4 in different concentrations: 0, 10, 25, 50
ng/mL. Protein level was measured by ELISA. The mean values and S.D. of
9 determinations from 3 independent experiments are shown. |
|
Fig. 2. Effect of IL-4 (25
ng/mL), IL-13 (25 ng/mL) and TNF-
(10 ng/mL) on CCL26 release by BEAS-2B cells at 24, 28 and 72 h after
stimulation. Protein level was measured by ELISA. The mean values and
S.D. of 9 determinations from 3 independent experiments are shown. *p<0.05
as compared to 24 hours after stimulation; #p<0.05 as compared to 48
hours after stimulation. |
|
Fig. 3. Effect of TNF-
on CCL26 release by BEAS-2B at 48 h after stimulation. Cells were treated
with IL-4 (25 ng/mL) or IL-13 (25 ng/mL) alone or in combination with
different concentrations of TNF-
(10, 25, 50 ng/mL). Protein level was measured by ELISA. The mean values
and S.D. of 9 determinations from 3 independent experiments are shown.
#p<0,05 as compared to unstimulated cells; ^p<0,05 as compared to
cells stimulated with IL-4, *p<0,05 as compared to cells stimulated
with IL-13. |
All data concern eotaxin-1 and eotaxin-3 only, since eotaxin-2 could not be detected as protein or mRNA in any experimental variant.
Effect of tumor necrosis factor-a on eotaxin expression
The effects of TNF-
on CCL11 production by BEAS-2B stimulated with Th2 cytokines and the effects
of the PDE4 inhibitors on CCL11 production in the presence/absence of TNF-
are shown on
Fig. 5.
Fig. 6 shows analogous data concerning CCL26.
TNF-
significantly
increased the production of the both CCL11 and CCL26 in cultures stimulated
with IL-4 or IL-13. In cell cultures stimulated with IL-4 and TNF-
the mean concentration of CCL11 was increased from undetectable level (
Fig.
5A) to 213 pg/mL (
Fig. 5C) and from 10 (
Fig. 5B) to 109 pg/mL
in culture stimulated with IL-13 (
Fig. 5D). TNF-
increased production from 363 (
Fig. 6A) to1237 pg/mL (
Fig. 6C)
and from 431 to 1096 pg/mL in cultures stimulated with IL-4 or IL-13, respectively.
Notably in unstimulated cultures treated with TNF-
, the level of eotaxins did not exceed a few pg/mL (
Fig. 4). Moreover,
we observed inhibition of CCL26 release in cultures stimulated TNF-
alone (
Fig. 3).
|
Fig. 4. Effect of cytokines,
TNF-, PDE4
inhibitors, and dexamethasone on CCL11 and CCL26 release by BEAS-2B cells.
Eotaxin accumulation in the medium was measured by ELISA at 48 h after
stimulation. The mean values and S.D. of 6-10 determinations from 3-5
independent experiments are shown. Rol-Rolipram (10 µM); RO-Ro-20-1724
(10 µM); Dx-dexamethasone (10 µM); IL-4 (25 ng/mL); IL-13
(25 ng/mL). A - CCL11, B - CCL26. |
|
Fig. 5. Effect of PDE4 inhibitors
and dexamethasone on CCL11 release by BEAS-2B cells stimulated by IL-4
(A) or IL-13 (B); and co-stimulated with TNF-
(C,D). Eotaxin accumulation in the medium was measured by ELISA
at 48 h after stimulation. The mean values and S.D. of 10 determinations
from 5 independent experiments are shown. Rol-Rolipram (10 µM);
RO-Ro-20-1724 (10 µM); Dx-dexamethasone (10 µM); TNF-
(10 ng/mL); IL-4 (25 ng/mL); IL-13 (25 ng/mL). *p<0.05 compared with
cells stimulated with IL-13 (B); *p<0.05 compared with cells
stimulated with appropriate cytokine+
TNF- (C,D).
(A,B) - CCL11 after stimulation with IL-4 or IL13; (C,D)
- after co-stimulation with TNF-. |
|
Fig. 6. Effect of PDE4 inhibitors
and dexamethasone on CCL26 release by BEAS-2B cells stimulated with IL-4
(A) or IL-13 (B); co-stimulated with TNF-
(C,D). Eotaxin accumulation in the medium was measured by ELISA
at 48 hour after stimulation. The mean values and S.D. of 10 determinations
from 5 independent experiments are shown. Rol-Rolipram (10 µM);
RO-Ro-20-1724 (10 µM); Dx-dexamethasone (10 µM); TNF-
(10 ng/mL); IL-4 (25 ng/mL); IL-13 (25 ng/mL). *p<0.05 compared with
cells stimulated with appropriate cytokine (A,B); *p<0.05 compared
with cells stimulated with appropriate cytokine+TNF-
(C,D). (A,B) - CCL26 after stimulation with IL-4 or IL13;
(C,D) - after co-stimulation with TNF-. |
Effect of PDE4 inhibitors on eotaxin expression
As is shown on
Fig. 4, the levels of CCL11 in non-stimulated culture
were below their detection limits; the CCL26 concentration reached only 20 pg/mL.
Fig. 4 demonstrate that neither of the two PDE4 inhibitors, nor dexamethasone
influenced the release of CCL11 and CCL26 in unstimulated cultures of BEAS-2B
cells. In cultures stimulated with Th2 cytokines, the concentration of CCL26
was significantly higher than CCL11 and reached 750 pg/mL and 670 pg/mL
versus
undetectable level and 10 pg/mL after stimulation with IL-4 or IL-13, respectively.
It is noteworthy that in our experimental conditions the concentration of CCL11
in cultures stimulated by IL-4 was below limit of the detection (
Fig. 5A).
We observed significant differences in the effect of PDE4 inhibitors on eotaxin expression measured both at the protein and mRNA level in the cell cultures stimulated with the Th2 cytokines which depends on the presence of TNF-
.
The PDE4 inhibitors had slightly effects on eotaxin expression in cultures stimulated
by Th2 cytokines alone, both at the protein (
Fig. 5A, 5B, Fig. 6A, 6B)
and the mRNA levels (
Fig. 7A, 7B; Fig. 8A, 8B). Statistically significant
effects were observed only in the two cases: CCL11 protein concentration in
the culture stimulated with IL-13 was lowered by pretreatment with rolipram
(
Fig. 5B) and CCL26 gene expression surprisingly was increased in cells
pretreated with rolipram before stimulation with IL-4 (
Fig. 8A).
|
Fig. 7. Effect of PDE4 inhibitors
on CCL11 gene expression in BEAS-2B cells at 48 h after stimulation with
IL-4 (A) or IL-13 (B) or after co-stimulation with TNF-
(C,D). Gene expression was measured by real time PCR as relative
quantification. Gene expression after stimulation with cytokines alone
(A) or cytokine+TNF-
(B) was considered as 100%. The mean values and S.D. of 9 determinations
from 3 independent experiments are shown. Rol-Rolipram (10 µM);
RO-Ro-20-1724 (10 µM); IL-4 (25 ng/mL); IL-13 (25 ng/mL). *p<0.05
as compared to stimulation with IL-4+TNF-
or IL-13+TNF-
respectively. (A,B) - CCL11 after stimulation with IL-4 or IL13;
(C,D) - after co-stimulation with TNF-. |
|
Fig. 8. Effect of PDE4 inhibitors
on CCL26 gene expression in BEAS-2B cells at 48 h after stimulation with
IL-4 (A) or IL-13 (A) or after co-stimulation with TNF-
(C,D). Gene expression was measured by real time PCR as relative
quantification. Gene expression after stimulation with cytokines alone
(A,B) or cytokine+TNF-
(C,D) was considered as 100%. The mean values and S.D. of 9 determinations
from 3 independent experiments are shown. Rol-Rolipram (10 µM);
RO-Ro-20-1724 (10 µM); IL-4 (25 ng/mL); IL-13 (25 ng/mL). *p<0.05
as compared to stimulation with IL-4 (A); *p<0.05 compared to
stimulation with IL-4+TNF-
or IL-13+TNF-
respectively (C,D). (A,B) - CCL 26 after stimulation with
IL-4 or IL-13; (C,D) - after co-stimulation with TNF-. |
The situation was different when TNF-
was used in co-stimulation with the Th2 cytokines. In the most cases, pretreatment
of cells with PDE4 inhibitors decreased the concentrations of CCL11 and CCL26
in culture media regardless of the cytokine used, although the effect was statistically
significant in two cases only. They were: the effect of rolipram on the production
of CCL11 (
Fig. 5C) and the effect of RO-20-1724 on the concentration
of CCL26 (
Fig. 6C), both in culture stimulated with IL-4 and TNF-
. Only in one case the pretreatment with a PDE4 inhibitor increased the mean
level of the eotaxin protein but not in statistically significant way. It was
the CCL26 protein in the culture stimulated with IL-13 after pretreatment with
RO-20-1724 (
Fig. 6D).
The most pronounced effects of PDE4 inhibitors on inhibition of eotaxin production
in cells stimulated with the cytokines in the presence of TNF-
was observed at the mRNA level (
Fig. 7CD, Fig. 8CD). In cells stimulated
with IL-4 and TNF-
the both inhibitors decreased the mRNA level of both chemokines: for CCL11 the
decrease was by 34 and 37% for rolipram and RO-20-1724, and for CCL26-43 and
47%, respectively. For cells stimulated with IL-13 and TNF-
, only rolipram had a statistically significant effect (expression of both eotaxins
was decreased by ca. 50%). The effect of RO-20-1724, although also inhibitory
was not statistically significant.
Effect of dexamethasone on eotaxin expression
Dexamethasone, used in our experiments as a reference inhibitor of allergic reactions, was the most effective in inhibition of the synthesis of eotaxins regardless of the stimulation agent used.
DISCUSSION
In this study we show that the inhibitory effects of PDE4 inhibitors on eotaxin expression may be dependent on TNF-
contribution. To our knowledge this is the first study concerning direct effects of rolipram and RO-20-1724 on eotaxin expression in an established line of human bronchial epithelial cells. There are some earlier publications about the effects of PDE4 inhibitors on eotaxin expression (33-35, 38) but those studies were performed using experimental systems different from ours (animal models, other type of cultured cells, different eotaxin stimulators and their concentrations, different duration of culture), therefore their results cannot be directly compared with the present ones.
Most authors of similar studies chose earlier time point for measure eotaxin release, because it is known that bronchial epithelial cells begin eotaxin production ca. 2 hours after stimulation (20, 39). It was also shown that although concentration of CCL11 in pulmonary epithelial cell lysates was growing from second hour after stimulation but it is secreted most effectively to the medium at 48 hour (14).
Similarly to our results, the absence of CCL24 protein and mRNA in BEAS-2B culture was observed by other authors. According to Kobayashi
et al. (40), in experiments performed with the same cell line, CCL11, CCL26, but not CCL24 mRNA expression was induced by stimulation with IL-13 or IL-4. In their experiments CCL26 was the only one detected as protein after cytokine stimulation. Our experiments partly confirm those observations. We also did not find the CCL24 protein or mRNA but we detected the CCL11 protein, although its concentration was extremely low. Banwell
et al., studying another bronchial epithelial cell line, also did not detect CCL24 gene expression after similar cytokine stimulation (20). On the other hand Komiya
et al. (41) in experiments performed with BEAS-2B cells stimulated with IL-13 or IL-4 with/without TNF-
found all three eotaxin proteins. In their studies the concentrations of CCL11, CCL24 and CCL26 after stimulation with IL-4 were: 3766, 19, and 36305 pg/mL, respectively, thus incomparably higher than in our experiments. It seems that the use of the different medium (LHC-8; DMEM/HAM's F12K+5% FCS), ELISA kit (made by authors using newly established antibody against CCL11, CCL24, CCL26), and concentrations of cytokines could be the reason for the apparent absence of the CCL24 protein in our experiment. Nevertheless, despite the different eotaxin protein concentrations reported, we also observed the highest production of CCL26 after IL-4 or IL-13 stimulation, and the same proportions of produced eotaxin similarly to Komiya
et al.
It is known that the key players in eotaxin expression are IL-4, IL-13 and TNF-
Numerous authors have shown that either Th2 cytokine or TNF-
alone are able to stimulate bronchial epithelial cells to produce eotaxins but
this effect is much more stronger when they are added together. Fuijsawa
et
al. showed that CCL11 expression in BEAS-2B cells depends on TNF-
addition to IL-4 (10 ng/mL) in dose dependent manner (42). It was shown that
TNF-
alone can
effectively induce CCL11 but not CCL26 production (20, 39, 43), probably because
of differences in the structure of their promoters. TNF-
act through NFkB pathway and Th2 cytokines with STAT6. CCL11 promoter region
contains binding sites for the NF
B
and STAT6 factors which lay near and even overlap (44) since such dependency
was not shown in CCL26 promoter. This explains the impact of TNF-
on CCL11 expression.
In our experiments TNF-
affected expression of CCL11 more than the expression of CCL26. Simultaneous stimulation with a Th2 cytokine and TNF-
enhanced about 100-fold (IL-13) and about 200-fold (IL-4) compared to Th2 cytokine alone. In the case of CCL26 this increase was only about 15-fold. Such stronger effect of TNF-
towards CCL11 was observed by other authors as well (20, 41, 43).
In our experiments the PDE4 inhibitors decreased production of eotaxins only in BEAS-2B cells co-stimulated with TNF-
with one exception - CCL11 reduction after rolipram preincubation and IL-13 stimulation. This effect was not confirm with RO-20-1724, probably the dose of RO-20-1724 was too low to inhibit protein release - the decrease on molecular level was shown but without statistical significance. It may be discussed on a biochemical as well as a molecular level. Firstly, in cells treated with both, TNF-
and the cytokine, the concentration of intracellular cAMP will be dependent on the summarized effects of the stimulators. Intercellular concentration of cAMP is regulated by a balance between its synthesis and decomposition (45). A few authors proved that eotaxin expression is connected with the process of cAMP evaluation in bronchial epithelial cells. cAMP probably got indirect effect on eotaxin expression. The activity of the main kinases which take part in eotaxin expression pathway are dependent on PKA - a main cAMP effector. After stimulation with IL-4 both forskolin - the direct activator of adenylyl cyclase, and 8Br-cAMP - the cAMP analog, decrease CCL11 production after IL-1b stimulation in airway smooth muscle cells. These process depends on PKA (46, 47). Experimental data concerning the effects of IL-13 on intercellular cAMP in BEAS-2B are lacking but our results suggest that IL-4 can probably be connected with cAMP pathway more than IL-13 because most of statistically significant changes were established in cultures treated with IL-4. Probably the higher dose of PDE4 inhibitors is needed to decrease the eotaxin expression after IL-4 and IL-13 stimulation. But the increase of the drug dose cause the increase of the toxicity and side effects.
In early studies performed on endothelial cells by Koga
et al. TNF-
was shown to reduce intercellular cAMP content at least partially increasing cyclic nucleotide phosphodiesterase activity (48). Data presented by Emala
et al. showed that TNF-
reduced also adenylyl cyclase activity in airway smooth muscle cells (49). Those observations may explain the effectiveness of PDE4 inhibitors in limiting eotaxin expression only in cultures co-stimulated with TNF-
. May be, in our experiments the effectiveness of PDE4 inhibitors were conditioned by a sufficiently low cAMP concentration. On the other hand there are only our assumptions because we optimized experimental conditions mainly for CCL26 and not assessed the levels of cAMP. Relationship of cAMP level and the effectiveness of PDE4 inhibitors in various culture conditions needs further experimental findings. We can suppose that in our experimental conditions the whole cAMP concentration after pretreatment with PDE4 inhibitors and stimulations with IL-4, IL-13, TNF-
was big enough to cause the decrease of eotaxin expression only in the cultures of cells treated simultaneously with Th2 cytokines and TNF-
.
Secondly, the effects of PDE4 inhibitors may also be explained at the level
of transcription factors and protein kinases. Thus: induction of CCL11 and CCL26
production in response to TNF-
plus IL-4 stimulation of human lung fibroblast involved activation of NF
B
and STAT6 with participation of p38 mitogen-activated protein kinase (MAPK)
for both chemokines and, additional by MEK (MAPK/ERK) for CCL26. It is known
that rolipram precludes NFk
B
binding to gene promoters by stopping the phosphorylation and degradation of
I
B subunit, which
blocks the breakdown of the I
B-NF
B
complex and activation of the NF
B
subunit (50). This effect is probably indirect - authors conclude that rolipram
partly inhibited p65 subunit translocation to the nucleus. Some authors have
suggested that the increase of PKA activity after cAMP elevation can inhibit
MAPK, ERK and cJNK and in this way affect the IL-4 signaling pathway (51, 52).
There are no reports regarding the effect of increased cAMP level on STAT6 pathway.
Full elucidation of the mechanisms of PDE4 inhibitors' action on eotaxin expression
needs further research, and the effect of PDE4 inhibitors on STAT6 should be
determinated.
In conclusion, we have demonstrated that the effect of PDE4 inhibitors on eotaxin expression in cultured bronchial epithelial cells, stimulated with IL-4 or IL-13 may be depended on TNF-
. Increased levels of the both IL-4 and IL-13 as well as TNF-
are characteristic for the airway of asthmatic patients, thus their lung epithelium is under continuous stimulation for eotaxin production. The fact that PDE4 enzymes are widely present in the respiratory tract predisposes their inhibitors to local application. Therefore it seems that PDE4 inhibitors can be especially helpful in local - inhaled. Much lower dose of inhaled form of PDE4 inhibitor is needed to stop the late phase airflow obstruction and inflammatory call influx into lungs than orally given form. Moreover only inhaled administration of PDE4 inhibitor is effective in the improvement of lung function in allergen challenged animals. These results are supportive of the concept that inhaled PDE4 inhibition will have beneficial effects in the lungs that may not be seen with oral PDE4 inhibitors (53, 54).
Conflict of interests: None declared.
REFERENCES
- Hurley JH. Structure, mechanism, and regulation of mammalian adenylyl cyclase. J Biol Chem 1999; 274: 7599-7602.
- Essayan DM. Cyclic nucleotide phosphodiesterases. J Allergy Clin Immunol 2001; 108: 671-680.
- Tasken K, Aandahl EM. Localized effects of cAMP mediated by distinct routes of protein kinase A. Physiol Rev 2004; 84: 137-167.
- Sanz MJ, Cortijo J, Morcillo EJ. PDE4 inhibitors as new anti-inflammatory drugs: effects on cell trafficking and cell adhesion molecules expression. Pharmacol Ther 2005; 106: 269-297.
- Spina D. PDE4 inhibitors: current status. Br J Pharmacol 2008; 155: 308-315.
- Wright LC, Seybold J, Robichaud A, Adcock IM, Barnes PJ. Phosphodiesterase expression in human epithelial cells. Am J Physiol Lung Cell Mol Physiol 1998; 275: L694-L700.
- Fuhrmann M, Jahn HU, Seybold J, et al. Identification and function of cyclic nucleotide phosphodiesterase isoenzymes in airway epithelial cells. Am J Respir Cell Mol Biol 1999; 20: 292-302.
- Rabe KF, Bateman ED, O'Donnell D, Witte S, Bredenbroker D, Bethke TD. Roflumilast-an oral anti-inflammatory treatment for chronic obstructive pulmonary disease: a randomised controlled trial. Lancet 2005; 366(9485): 563-571.
- Calverley PM, Sanchez-Toril F, McIvor A, Teichmann P, Bredenbroeker D, Fabbri LM. Effect of 1-year treatment with roflumilast in severe chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2007; 176: 154-161.
- Rennard SI, Schachter N, Strek M, Rickard K, Amit O. Cilomilast for COPD: results of a 6-month, placebo-controlled study of a potent, selective inhibitor of phosphodiesterase 4. Chest 2006; 129: 56-66.
- Vestbo J, Tan L, Atkinson G, Ward J. UK-500,001 Global Study Team. A controlled trial of 6-weeks' treatment with a novel inhaled phosphodiesterase type-4 inhibitor in COPD. Eur Respir J 2009; 33: 1039-1044.
- Calverley PM, Rabe KF, Goehring UM, Kristiansen S, Fabbri LM, Martinez FJ. M2-124 and M2-125 study groups: roflumilast in symptomatic chronic obstructive pulmonary disease: two randomised clinical trials. Lancet 2009; 374(9691): 685-694.
- Fabbri LM, Calverley PM, Izquierdo-Alonso JL, et al. M2-127 and M2-128 study groups. Roflumilast in moderate-to-severe chronic obstructive pulmonary disease treated with longacting bronchodilators: two randomised clinical trials. Lancet 2009; 374(9691): 695-703.
- Lilly CM, Nakamura H, Kesselman H, et al. Expression of eotaxin by human lung epithelial cells induction by cytokines and inhibition by glucocorticoids. J Clin Invest 1997; 99: 1767-1773.
- Rokudai A, Terui Y, Kuniyoshi R, et al. Differential regulation of eotaxin-1/CCL11 and eotaxin-3/CCL26 production by the TNF-alpha and IL-4 stimulated human lung fibroblast. Biol Pharm Bull 2006; 29: 1102-1109.
- Lilly CM, Nakamura H, Belostotsky OI, et al. Eotaxin expression after segmental allergen challenge in subjects with atopic asthma. Am J Respir Crit Care Med 2001; 163: 1669-1675.
- Conroy DM, and Williams TJ. Eotaxin and the attraction of eosinophils to the asthmatic lung. Respir Res 2001; 2: 150-156.
- Rahman MS, Yamasaki A, Yang J, Shan L, Halayko AJ, Gounni AS. IL-17a induced eotaxin-1/CC chemokine ligand 11 expression in human airway smooth muscle cells: role of MAPK (Erk1/2, and p38) pathways. J Immunol 2006; 177: 4064-4071.
- Badewa AP, Hudson CE, Heiman AS. Regulatory effects of eotaxin, eotaxin-2, and eotaxin-3 on eosinophil degranulation and superoxide anion generation. Exp Biol Med 2002; 227: 645-651.
- Banwell ME, Tolley NS, Williams TJ, Mitchel TJ. Regulation of human eotaxin-3/CCL26 expression: modulation by cytokines and glucocorticoids. Cytokine 2002; 17: 317-323.
- Watanabe K, Jose PJ, Rankin SM. Eotaxin-2 generation is differentially regulated by lipopolysaccharide and IL-4 in monocytes and macrophages. J Immunol 2002; 168: 1911-1918.
- Heinemann A, Hartnell A, Stubbs VE, et al. Basophil responses to chemokines are regulated by both sequential and cooperative receptor signaling. J Immunol 2000; 165: 7224-7233.
- Daugherty BL, Siciliano SJ, DeMartino JA, Malkowitz L, Sirotina A, Springer MS. Cloning, expression, and characterization of the human eosinophil eotaxin receptor. J Exp Med 1996; 183: 2349-2354.
- Brown IR, Kleimberg J, Marini M, Sun G, Bellini A, Mattoli S. Kinetics of eotaxin expression and its relationship to eosinophil accumulation and activation in bronchial biopsies and bronchoalveolar lavage (BAL) of asthmatic patients after allergen inhalation. Clin Exp Immunol 1998; 114: 137-146.
- Ravensberg AJ, Ricciardolo FL, van Schadewijk A. Eotaxin-2 and eotaxin-3 expression with persistent eosinophilic bronchial inflammation in patients with asthma after challenge. J Allergy Clin Immunol 2005; 115: 779-785.
- Berkman N, Ohnona S, Chung FK, Breuer R. Eotaxin-3 but not eotaxin gene expression is upregulated in asthmatics 24 hours after allergen challenge. Am J Respir Cell Mol Biol 2001; 24: 682-687.
- Jones NA, Boswell-Smith V, Lever R, Page CP. The effect of selective phosphodiesterase isoenzyme inhibition on neutrophil function in vitro. Pulm Pharmacol Ther 2005; 18: 93-101.
- Houslay MD, Schafer P, Zhang KY. Keynote review: phosphodiesterase-4 as a therapeutic target. Drug Discov Today 2005; 10: 1503-1519.
- Eskandari N, Wickramasinghe T, Peachell PT. Effects of phosphodiesterase inhibitors on interleukin-4 and interleukin-13 generation from human basophils. Br J Pharmacol 2004; 142: 1265-1272.
- Clayton RA, Dick CA, Mackenzie A, et al. The effect of selective phosphodiesterase inhibitors, alone and in combination, on a murine model of allergic asthma. Respir Res 2004; 5: 4.
- Mokry J, Mokra D, Nosalova G, Beharkova M, Feherova Z. Influence of selective inhibitors of phosphodiesterase 3 and 4 on cough and airway reactivity. J Physiol Pharmacol 2008; 59(Suppl 6): 473-482.
- Busch CJ, Graveline AR, Jiramongkolchai K, Liu H, Sanchez LS, Bloch KD. Phosphodiesterase 3A expression is modulated by nitric oxide in rat pulmonary artery smooth muscle cells. J Physiol Pharmacol 2010; 6: 663-669.
- Pang L, Knox AJ. Regulation of TNF-alpha-induced eotaxin release from cultured human airway smooth muscle cells by beta2-agonists and corticosteroids. FASEB J 2001; 15: 261-269.
- Sabatini F, Petecchia L, Boero S, et al. A phosphodiesterase 4 inhibitor, roflumilast N-oxide, inhibits human lung fibroblast functions in vitro. Pulm Pharmacol Ther 2010; 23: 283-291.
- Santamaria LF, Palacios JM, Beleta J. Inhibition of eotaxin-mediated human eosinophil activation and migration by the selective cyclic nucleotide phosphodiesterase type 4 inhibitor rolipram Br J Pharmacol 1997; 121: 1150-1154.
- Liu J, Munoz NM, Meliton AY, et al. Beta2-integrin adhesion caused by eotaxin but not IL-5 is blocked by PDE-4 inhibition and beta2-adrenoceptor activation in human eosinophils. Pulm Pharmacol Ther 2004; 17: 73-79.
- Nejman-Gryz P, Grubek-Jaworska H, Glapinski J, Hoser G, Chazan R. Effects of the phosphodiestrase-4 inhibitor rolipram on lung resistance and inflammatory reaction in experimental asthma. J Physiol Pharmacol 2006; 57(Suppl 4): 229-239.
- Silva PM, Alves AC, Serra MF, et al. Modulation of eotaxin formation and eosinophil migration by selective inhibitors of phosphodiesterase type 4 isoenzyme. Br J Pharmacol 2001; 134: 283-294.
- Stellato C, Matsukura S, Fal A, et al. Differential regulation of epithelial-derived C-C chemokine expression by IL-4 and the glucocorticoid budesonide. J Immunol 1999; 163: 5624-5632.
- Kobayashi I, Yamamoto S, Nishi N, et al. Regulatory mechanisms of Th2 cytokine-induced eotaxin-3 production in bronchial epithelial cells: possible role of interleukin 4 eceptor and nuclear factor-kappaB. Ann Allergy Asthma Immunol 2004; 93: 390-397.
- Komiya A, Nagase H, Yamada H, et al. Concerted expression of eotaxin-1, eotaxin-2, and eotaxin-3 in human bronchial epithelial cells. Cell Immunol 2003; 225: 91-100.
- Fujisawa T, Kato Y, Atsuta J, et al. Chemokine production by the BEAS-2B human bronchial epithelial cells: differential regulation of eotaxin, IL-8, and RANTES by TH2- and TH1-derived cytokines. J Allergy Clin Immunol 2000; 105: 126-133.
- Matsukura S, Stellato C, Georas SN, et al. Interleukin-13 upregulates eotaxin expression in airway epithelial cells by a STAT6-dependent mechanism. Am J Respir Cell Mol Biol 2001; 24: 755-761.
- Matsukura S, Stellato C, Plitt JR, et al. Activation of eotaxin gene transcription by NFkB and STAT6 in human airway epithelial cells. J Immunol 1999; 163: 6876-6883.
- Torphy TJ. Phosphodiesterase isozymes: molecular targets for novel antiasthma agents. Am J Respir Crit Care Med 1998; 157: 351-370.
- Chu YT, Chang TT, Jong YJ, et al. Suppressive effects of formoterol and salmeterol on eotaxin-1 in bronchial epithelial cells. Pediatr Allergy Immunol 2010: 21: 345-352.
- Wuyts WA, Vanaudenaerde BM, Dupont LJ, Demedts MG, Verleden GM. Modulation by cAMP of IL-1beta-induced eotaxin and MCP-1 expression and release in human airway smooth muscle cells. Eur Respir J 2003; 22: 220-226.
- Koga S, Morris S, Ogawa S, et al. TNF modulates endothelial properties by decreasing cAMP. Am J Physiol 1995; 268: C1104-C1113.
- Emala CW, Kuhl J, Hungerford CL, Hirshman CA. TNF-alpha inhibits isoproterenol-stimulated adenylyl cyclase activity in cultured airway smooth muscle cells. Am J Physiol 1997; 272: L644-L650.
- Herve R, Schmitz T, Evain-Brion D, Cabrol D, Leroy MJ, Mehats C. The PDE4 inhibitor rolipram prevents NF-kappaB binding activity and proinflammatory cytokine release in human chorionic cells. J Immunol 2008; 181: 2196-2202.
- Kwak HJ, Song JS, Heo JY, Yang SD, Nam JY, Cheon HG. Roflumilast inhibits lipopolysaccharide-induced inflammatory mediators via suppression of nuclear factor-kappaB, p38 mitogen-activated protein kinase, and c-Jun NH2-terminal kinase activation. J Pharmacol Exp Ther 2005; 315: 1188-1195.
- Markova TP, Niwa A, Yamanishi H, Aragane Y, Higashino H. Antagonism of IL-4 signaling by a phosphodiesterase-4 inhibitor, rolipram, in human T cells. Int Arch Allergy Immunol 2007; 143: 216-224.
- Chapman RW, House A, Jones H, et al. Effect of inhaled roflumilast on the prevention and resolution of allergen-induced late phase airflow obstruction in Brown Norway rats. Eur J Pharmacol 2007; 571: 215-221.
- Celly CS, House A, Jones H, Hey JA, Chapman RW. Prevention and resolution of antigen-induced alterations in lung function of allergic Brown Norway rats by a PDE4 inhibitor, roflumilast. Am J Respir Crit Care Med 2005; 12: A95.