Original article | DOI: 10.26402/jpp.2021.2.14

T. FU, L. HOU, Y. DU

THE FACTORS INVOLVED IN THE INDUCTION OF NEUTROPHIL
GELATINASE-ASSOCIATED LIPOCALIN OVEREXPRESSION IN RENAL
TUBULAR EPITHELIAL CELLS UNDER ENDOPLASMIC RETICULUM STRESS

Department of Pediatrics, Shengjing Hospital of China Medical University, Shenyang, China
Our previous work found that neutrophil gelatinase-associated lipocalin (NGAL) expression increases when endoplasmic reticulum stress (ERS) occurs in human kidney-2 (HK-2) tubular epithelial cells. However, the reason for this is not yet known. This study investigated the factors involved when inducing NGAL overexpression in HK-2 cells during ERS. The cells were divided into six groups: the control group (normal HK-2 cells), the ERS group (HK-2 cells cultured in complete medium with thapsigargin (TG)), the transfection group (HK-2 cells transfected with activating transcription factor 4 small interfering ribonucleic acid (ATF4 siRNA), the ERS after transfection group (HK-2 cells transfected with ATF4 siRNA, then cultured in complete medium with TG), the negative control group (HK-2 cells transfected with siRNA-negative contrast), and the dimethyl sulfoxide (DMSO) group (HK-2 cells cultured in complete medium with DMSO). Western blot and a real-time polymerase chain reaction were used to measure the expression of protein and messenger ribonucleic acid (mRNA). As a result NGAL, ATF4, C/EBP homologous protein, glucose-regulated protein 78 kDa, ATF4 mRNA, and NGAL mRNA were clearly overexpressed in the ERS group compared with the control group (p < 0.05). The expression of NGAL and ATF4 were similar in the control group, the negative control group, and the DMSO group (p > 0.05). Meanwhile, ATF4, NGAL, ATF4 mRNA, and NGAL mRNA in the ERS after transfection group were significantly lower compared with the ERS group (p < 0.05), which showed that NGAL was affected by ATF4. There was a close correlation between NGAL and ATF4; when the expression of ATF4 was inhibited, NGAL was significantly lower. Therefore, ATF4 may be one of the upstream regulators of NGAL.
Key words:
human renal tubular epithelial cells, endoplasmic reticulum stress, neutrophil gelatinase-associated lipocalin, activating transcription factor 4, thapsigargin, endoplasmic reticulum stress, transfection

INTRODUCTION

Neutrophil gelatinase-associated lipocalin (NGAL), also known as lipocalin 2, ferriphage, and 24p3, is a small molecular protein belonging to the lipoprotein family. It has a molecular weight of 25 kDa and is composed of an N-terminal 310-helix, a C-terminal α helix, and an eight-stranded β-barrel structure of the polypeptide chain protein (1). NGAL has been used to estimate the prognosis of disease and assist in renal replacement therapy (2-5).

Three signal receptors, namely protein kinase ribonucleic acid (RNA)-like endoplasmic reticulum kinase, inositol regulating enzyme 1, and activating transcription factor (ATF6), are involved in endoplasmic reticulum stress (ERS) and activate the translation of activating transcription factor 4 (ATF4) by inhibiting messenger ribonucleic acid (mRNA) translation with phosphorylated eukaryotic initiation factor 2 subunit 1 (6). ATF4 initiates autophagy to maintain homeostasis by selectively mediating autophagy-related genes (7). Research evidence has shown that an unfolded protein response can stimulate NGAL synthesis in ERS (8) and that NGAL is in a state of low expression in mouse embryonic fibroblasts without the ATF4 gene when an ERS response mediated by albumin occurs (8). Our research team has reported that NGAL expression increased when ERS occurred in human kidney-2 (HK-2) tubular epithelial cells (9, 10). However, the relationship between NGAL and ATF4 is unclear. In this study, HK-2 cells were used to investigate the regulatory mechanism of NGAL overexpression during ERS.

MATERIALS AND METHODS

Materials

HK-2 cells were obtained from the Chinese Academy of Sciences (Shanghai, China) and preserved in liquid nitrogen. The following materials were used: toxic carotene (Sigma Aldrich, St. Louis, MO, USA), trypsin (Gibco, Dublin, Ireland), high-glucose Dulbecco’s Modified Eagle Medium (DMEM) (Hyclone, Logan, UT, USA), fetal bovine serum (FBS) (Hyclone, Logan, UT, USA), thapsigargin (TG), ATF4 rabbit monoclonal antibody (ab184909; Abcam, Cambridge, UK), NGAL rabbit monoclonal antibody (ab125075; Abcam, Cambridge, UK), C/EBP homologous protein (CHOP) mouse monoclonal antibody (ab11419; Abcam, Cambridge, UK), glucose-regulated protein 78 kDa (GRP78) rabbit monoclonal antibody (ab108613; Abcam, Cambridge, UK), horseradish peroxidase (HRP) Sheep Anti-rabbit IgG antibody (A21020; Abbkine, Wuhan, China), HRP/Sheep Anti-mouse IgG antibody (A21010; Abbkine, Wuhan, China), phosphate-buffered saline (PBS) buffer (0.01mol/L phosphate buffer), LipofectamineTM 3000 reagent (Invitrogen, Waltham, MA, USA), PCR primers (Sangon Biotech, Shanghai, China):
ATF4-F: TTCTCCAGCGACAAGGCTAAGG,
ATF4-R: CTCCAACATCCAATCTGTCCCG,
NGAL-L: GTGAGCACCAACTACAACCAGC,
NGAL-R: GTTCCGAAGTCAGCTCCTTGGT and small interfering ribonucleic acid (siRNA) oligo sequence synthetic dry powder (GenePharma Co., Ltd. Shanghai, China) 5’-3’ sequence: CUGCUUUGCCAUGAUT /AUCAUUGGCAACG UAAGCAGTT).

Cell culture

The HK-2 cells were cultured in a DMEM high-glucose medium containing 10% FBS and 100 μg/mL penicillin. The cells were transferred to a 25-mm cell culture flask and cultured at 37ºC in a fully saturated humidified incubator containing 5% CO2. After the cells were grown overnight until 80% confluent, a single-cell suspension was obtained by enzyme digestion using 0.25% trypsin solution. The cells were sub-cultured at a ratio of 1:2.

The treatment of HK-2 cells with thapsigargin

HK-2 cells of the same generation were divided into a control group and an ERS group. The HK-2 cells in the ERS group were cultured in complete medium with 5 µmol/L TG for eight hours (7). The Hk-2 cells in the control group were cultured in complete medium for eight hours, then the expression of CHOP and GRP78 were measured. If CHOP and GRP78 were high, it would confirm that TG can induce ERS in HK-2 cells.

SiRNA-ATF4 transfected HK-2 cells

1. The preparation of the cells before transfection

HK-2 cells were evenly seeded in six-well dishes for further culture. When the density of the cells reached 3.0 × 105 – 8.0 × 105 cells/well, the cells in each well were extensively washed with PBS and then added to 1.5 mL serum-free medium.

2. The preparation of the transfection reagent

Five uL lipofectamine 3000 and 200 mL serum-free medium were mixed together, as were 5 μL siRNA (ATF4 siRNA or siRNA negative contrast) and 200 mL serum-free medium. The transfection reagent was obtained by combining these two mixtures.

3. Transfection

The HK-2 cells were treated with the transfection reagent and cultured in an incubator. After 24 hours, the original medium was replaced with complete medium containing 2 mL serum.

Thapsigargin treated cells after transfection

The HK-2 cells were seeded in six-well dishes. When the cells were 70 – 80% confluent, they were divided into six groups: the control group (normal HK-2 cells cultured in 2 mL complete medium for 8 h), the ERS group (HK-2 cells cultured in complete medium with 5 µmol/L TG for 8 h), the transfection group (HK-2 cells transfected with ATF4 siRNA for 24 h, then cultured in 2 mL complete medium for 8 h), the ERS after transfection group (HK-2 cells transfected with ATF4 siRNA for 24 h, then cultured in 2 mL complete medium with 5 µmol/L TG for 8 h), the negative control group (HK-2 cells transfected by siRNA-negative contrast for 24 h, then cultured in 2 mL complete medium for 8 h), and the DMSO group (HK-2 cells cultured in complete medium with 5 μmol/L DMSO for 8 h). The protein and mRNA were extracted from each group.

Protein extraction and detection

Protein extraction took place in the following way. First, the culture medium of each group of cells was discarded. The cells were then washed with PBS, transferred to a 2 mL Eppendorf (EP) tube (A1–F1), and centrifuged at 4ºC/1000 rpm for 5 min, after which the supernatant was discarded. Forty μL radioimmunoprecipitation assay buffer and 1 μL phenylmethylsulfonyl fluoride were added to the EP tube, and it was vortexed for 10 s, then placed on an ice plate for 10 min. This was repeated three times. After centrifugation at 4ºC/10,000 for 30 min, the supernatant was removed to a 1.5 mL EP tube (A2–F2).

The protein concentration was measured using the bicinchoninic acid (BCA) method: BCA was diluted into different concentrations (0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg/mL). BCA working solution was prepared (the ratio of reagent A to B was 50:1). Protein solution of A2–F2, 1 μL, was diluted for each group, and then transferred into a new 1.5 mL EP tube (A3–F3). After this, 200 uL of BCA working solution and 20 uL of protein diluent were added to each well in 90 six-well dishes, which were then incubated at 37ºC for 30 min. The absorbance of each well was measured under A562 nm with an enzyme-linked immunosorbent assay. The standard curve was drawn with the protein content as the abscissa and absorbance as the ordinate, and the concentration of each sample was calculated. Finally, Western blot was used to obtain the bands.

RNA extraction and detection

1. The extraction of mRNA

The culture medium of each group of cells was discarded, after which the cells were washed with PBS and then transferred to a 2 mL EP tube (A1–F1) and centrifuged at 4ºC/1000 rpm for 5 min. The supernatant was then discarded. A 1000 uL lysis solution of RNA (TRIZOL) and 200 uL of chloroform was added to the EP tube. After centrifugation at 4ºC/14,000 for 15 min, the supernatant was removed to a 2-mL EP tube (A2–F2).

An equal volume of isopropanol was added to the EP tube, and then it was centrifuged at 4ºC/14,000 rpm for 15 min. After the supernatant was discarded, 500 μL of 70% ethanol was added, and it was centrifuged again at 4º/14,000 rpm for 5 min. More ethanol was added and the tube centrifuged for 5 min again, and the supernatant was discarded. The sediment was dried at room temperature, and 10 μl ddH2O was added to it.

2. The detection of mRNA concentration and purity

The instrument was zeroed using ddH2O, and then it was wiped dry before each measurement. The concentration and A260/A280 ratio were measured using 2 μL RNA diluent (a 100 times dilution of the original solution).

3. Reverse complementary deoxyribonucleic acid

Six 0.5 mL EP tubes (A3–F3) and a genomic deoxyribonucleic acid (gDNA) reverse transcription kit were used. In each group, 1.0 μL of gDNA Eraser, 2.0 μL of 5 × gDNA Eraser Buffer, and 1μg of RNA diluent was successively added to each tube. After this, ddH2O was added to make up the total volume of the mixture to 10 μL. After the resulting solution was thoroughly mixed together, the solution was placed in a gradient polymerase chain reaction (PCR) machine. The temperature was adjusted to 42ºC for 2 min, and then put down to 4ºC. The solution of each group was transferred to six new 0.5 mL EP tubes (A4–F4), and 1.0 μL of PrimeScript RT enzyme, 4.0 μL of 5 × PrimeScript Buffer 2 (for real-time), 1.0 uL of RT primer mix, 4.0 μL ddH2O, and 10 μL mixed solution (A3–F3) was added to each tube successively and mixed together well. The tubes were then put into the gradient PCR instrument again, and the temperature was set to 37ºC for 15 min, then 85ºC for 5 s, and then put down to 4ºC. The cDNA of each group was obtained.

4. Quantitative PCR amplification

A working solution was prepared using the PCR amplification kit. The components of each working solution sample were 10 μL SYBR @ Premium Ex TaqTM (×2), 2.0 uL PCR primers, 6.0 uL ddH2O, and 2.0 uL cDNA (A4–F4). The samples were added to the eight connected tubes according to a 20 μL/well. They were put in the centrifuge (2000 rpm) for 2 min and then placed in the fluorescent quantitative PCR instrument for 2 h to amplify. Afterwards, the corresponding amplification curve and cycle number were obtained for each group.

Statistical analysis

Gel-Pro Analyzer 4 was used to obtain the gray value of protein, and SPSS 19.0 was used for statistical analysis. The measurement data were expressed with mean ± SD. The data obtained was compared using an independent sample t-test. The results of each experiment were repeated at least three times, and p < 0.05 was considered statistically significant. The relative expression of RNA (2–ΔCT) was calculated and analyzed using SPSS 19.0 software, and P < 0.05 was seen as statistically significant.

RESULTS

The comparison of protein expression in each group (Fig. 1).

1. The comparison of activating transcription factor 4 (ATF4)

The results are shown in Table 1, Fig. 2A. Compared with the control group, ATF4 in the ERS group was significantly increased (f = 7.260, P = 0.007), but there was no significant change in the ERS after transfection group (f = 0.554, P = 0.457). The low expression state of ATF4 in the ERS after transfection group indicated the success of the transfection technology. As shown in Fig. 3, the expression of green fluorescence protein was observed under a fluorescent microscope with the estimated ratio of transfection for 70 – 75%, and the ATF4-mRNA relative expression levels in transfection group was lower than that of negative control group to confirm the feasibility of transfection indirectly. In addition, the expression of ATF4 in the transfection group, the DMSO group, and the negative control group were almost the same. The expression of ATF4 was significantly increased in the ERS group (f = 9.232, P = 0.002), but there was no significant difference in the transfection group and the ERS after transfection group (f = 2.804, P = 0.094). The results may have been due to the low expression of ATF4 after transfection.

Figure 1 Fig. 1. The bands as expression of GAPDH/CHOP/ATF4/NGAL in different groups, (a): control group; (b): ERS group; (c): DMSO group; (d): the negative control group; (e, f): transfection group; (g, h): the ERS after transfection group.

2. The comparison of C/EBP homologous protein (CHOP)

The results are shown in Table 1, Fig. 2B. Compared with the control group, CHOP as a marker of ERS was significantly increased in the ERS group (f = 12.327, P < 0.001), but there was no significant change in CHOP expression in the transfection group, the DMSO group, and the negative control group. In the ERS after transfection group, CHOP was significantly increased (f = 10.922, P = 0.001), but compared with the ERS group, the expression of CHOP was lower in the ERS after transfection group (f = 5.400, P = 0.020). However, CHOP expression in the ERS after transfection group was significantly higher than that in the transfection group (f = 8.836, P = 0.003).

Table 1. The relative expression of ATF4, NGAL, CHOP, and GRP78 in the six groups.
Table 1
1P < 0.05 versus control group; 2P < 0.05 versus ERS group.
ATF4, activating transcription factor 4; CHOP, C/EBP homologous protein; DMSO, dimethyl sulfoxide; ERS, endoplasmic reticulum stress; GRP78, glucose-regulated protein 78 kDa; NGAL, neutrophil gelatinase-associated lipocalin; TG, thapsigargin.
Figure 2
Fig. 2. (A): Relative expression levels of ATF4 in group; (B): Relative expression levels of CHOP in groups; (C): Relative expression levels of GRP78 in groups; (D): Relative expression levels of NGAL in groups; *P < 05 versus control groups.

3. The comparison of glucose-regulated protein 78 kDa (GRP78)

The results are shown in Table 1, Fig. 2C. Compared with the control group, the expressions of GRP78 in the ERS group (f = 13.720, P < 0.001) and the ERS after transfection group (f = 8.747, P = 0.003) were significantly increased. Compared with the ERS group, the expression of GRP78 in the ERS after transfection group was lower (f = 4.170, P = 0.041). It appeared that the decrease of ATF4 influenced the expression of CHOP but did not inhibit the occurrence of ERS.

4. The comparison of neutrophil gelatinase-associated lipocalin (NGAL)

The results are shown in Table 1, Fig. 2D. Compared with the control group, NGAL in the ERS group was significantly increased (f = 5.227, P = 0.022). Furthermore, there was no significant change in NGAL expression in the negative control group and the DMSO group. However, it was found that NGAL expression in the TG group was significantly increased (f = 13.179, P < 0.001) compared with the control group, the ERS group, the transfection group, and the ERS after transfection group. However, there was no significant change in the control group, transfection group, and the ERS after transfection group, which suggested that the inhibition of ATF4 expression affected NGAL production.

Figure 3
Fig. 3. Expression of green fluorescence protein: (A): HK-2 cells under the fluorescence microscope that have not been transfected; (B): HK-2 cells under the fluorescence microscope that have been successfully transfected; (C): The ATF4-mRNA relative expression levels of transfection group compared with negative control group. *P < 0.05 versus negative control groups.

The comparison of ATF4 mRNA and NGAL mRNA expression

1. A comparison between the endoplasmic reticulum stress (ERS) group and the control group

As shown in Fig. 4A and 4B, compared with the control group, the expression of ATF4 mRNA in the ERS group was 3.500 times greater, and the NGAL mRNA was 2.7386 times greater (P < 0.01).

2. A comparison between the ERS after transfection group and the control group

As shown in Fig. 4C and 4D, the expression of ATF4 mRNA in the ERS after transfection group was 0.7469 times that in the control group (P < 0.01), but there was no significant difference in the expression of NGAL in the two groups (P > 0.05).

Figure 4
Fig. 4. (A): Comparison of ATF4 mRNA expression between ERS group and control group; (B): Comparison of NGAL mRNA expression between ERS group and control group; (C): Comparison of ATF4 mRNA expression between ERS after transfection group and control group; (D): Comparison of NGAL mRNA expression between ERS after transfection group and control group. *P < 0.05 versus control groups.

3. A comparison between the transfection group and the control group

As shown in Table 2, the expression of ATF4 mRNA in the transfection group was significantly lower than that in the control group (P < 0.01), which indicates that ATF4 siRNA interferes with the expression of ATF4. There was no significant difference in NGAL mRNA expression between the two groups (P > 0.05).

Table 2. The comparison of expression of ATF4 mRNA and NGAL mRNA in the six groups studied in this study.
Table 2
ATF4, activating transcription factor 4; DMSO, dimethyl sulfoxide; ERS, endoplasmic reticulum stress; NGAL, neutrophil gelatinase-associated lipocalin.

4. A comparison between the negative control group, the dimethyl sulfoxide (DMSO) group, and the control group

As shown in Table 2, there was no significant difference in ATF4 mRNA and NGAL mRNA expression between the negative control group, the control group and the DMSO group (P > 0.05).

DISCUSSION

There have been a number of in vitro and in vivo studies that explore the inter-relationship between the pathogenesis of acute kidney injury (AKI) and ERS (11). In addition, NGAL is regarded as a sensitive acute phase protein for detecting ERS in kidney disease (12, 13). In normal conditions, NGAL is expressed at a low level in adult bone marrow, the uterus, prostate, stomach, the distal tubule epithelium of normal kidneys, the medullary collecting tube, and other organs, and it can be filtered out freely by the glomerulus and reabsorbed by the proximal tubules. NGAL cannot be detected in urine under normal conditions (14, 15). However, when cells are stimulated by external factors, the levels of NGAL in plasma and urine will increase significantly.

This study showed that GRP78 and CHOP were overexpressed after normal HK-2 cells were treated with 5 umol/L TG. These findings are consistent with our previous results (9) and confirm that TG can induce ER stress in HK-2 cells. The expression of ATF4 mRNA was also significantly reduced after transfection. It was shown that the expression of the ATF4 gene was inhibited after HK-2 cells were transfected with ATF4 siRNA. In the ERS after transfection group, NGAL and ATF4 were significantly lower than that in the ERS group, but there was no significant difference between the ERS after transfection group and the control group in the expression of NGAL and ATF4. One previous study found that NGAL protein expression in the blood and urine of children with AKI induced by sepsis was significantly higher, and its value in the early diagnosis of AKI was higher than that of creatinine (16). In addition, Jameela et al. conducted a prospective observation of children diagnosed with AKI and found that serum cystatin C (s-Cys-C) and NGAL in urine can be used in the early diagnosis of AKI in extreme cases and that urine NGAL is more sensitive than sCys-C (17, 18). Renal ischemia-reperfusion injury is one of the main causes of AKI, and it has been shown that NGAL has a positive correlation with renal ischemia-reperfusion injury and plays a protective role in the renal system. NGAL knockdown can cause a significant increase in creatinine and severe damage to cell morphology and accelerate apoptosis in renal tubular epithelial cells (19). Our study of the effects of exogenous NGAL pretreatment on an ischemia-reperfusion injury found that it can significantly reduce blood urea nitrogen and serum creatinine, indicating that NGAL has a protective effect on the renal system (20). NGAL pretreatment can reduce the apoptosis of renal tubular epithelial cells, promote the regeneration of renal tubular cells, and activate autophagy. In addition, NGAL can also be used as an iron carrier protein. Through an internalization reaction with the local receptor of the membrane, it can shuttle iron ions into the tissue, maintain the iron ion homeostasis, and promote cell proliferation and epithelial formation (21). This suggests that NGAL may be an effective therapeutic target of AKI and increasing NGAL expression may reduce ERS damage to cells. Collectively, these accumulated studies suggest an essential relationship between the NGAL pathway and ERS in medicating the condition of AKI.

The results of our study suggest that the expression of NGAL is affected by ATF4, and the inhibition of ATF4 gene transcription leads to a decrease in NGAL mRNA. A previous study demonstrated that the NGAL gene was directly connected to ATF4 by the phenomenon of failed induction of NGAL in an ATF4–/– cellular environment and overexpression in a AFT4+/+ cellular environment (22). These results are consistent with our study, which further demonstrates that NGAL may play an essential role in the progression of AKI. In our research, ERS induced by TG in HK-2 cells caused the specific translation of ATF4, which led to the further expression of NGAL. Thus, it appears that NGAL may activate apoptosis by accumulating intracellular iron, which can restore cellular homeostasis (23). In summary, our findings suggest that NGAL might be an effective way of restoring kidney function by attenuating the degree level of ERS and increasing expression of NGAL might be mediated by ATF4.

Our study provides an explanation of how the mechanism of NGAL overexpression works. The results suggest that the expression of NGAL is affected by ATF4 and the inhibition of ATF4 gene transcription leads to the decrease of NGAL mRNA. In addition, El Mokhtar et al. (24) found that NGAL as a marker of kidney injury was significantly increased after HEV stimulation for CD10+ /CD13+ primary proximal tubular (PT) cells cocultured with peripheral blood mononuclear cells (PBMCs), while was indifference as PT cells were stimulated by HEV alone. It showed HEV mediates renal injury was related with interaction between the immune cells and renal epithelium to induce the increase of NGAL. However, the cause of NGAL overexpression remain unclear, we need further confirmation and researches to clarify the role and regulatory mechanism of NGAL to provide a new perspective for treating AKI patients in the future.

REFERENCE

  1. Flower DR, North AC, Sansom CE. The lipocalin protein family: structural and sequence overview. Biochim Biophys Acta 2000; 1482: 9-24.
  2. Khawaja S, Jafri L, Siddiqui I, Hashmi M, Ghani F. The utility of neutrophil gelatinase-associated lipocalin (NGAL) as a marker of acute kidney injury (AKI) in critically ill patients. Biomark Res 2019; 7: 4. doi: 10.1186/s40364-019-0155-1
  3. Shoaib M, Mahmud S N, Safdar M. Early diagnosis of acute kidney injury by urinary neutrophil gelatinase associated lipocalin in adult critically ill patients. J Ayub Med Coll Abbottabad 2019; 31: 12-15.
  4. Budzynska A, Gawron-Kiszka M, Nowakowska-Dulawa E, et al. Serum neutrophil gelatinase-associated lipocalin (NGAL) correlates with clinical and endoscopic activity in ulcerative colitis but fails to predict activity in Crohn’s disease. J Physiol Pharmacol 2017; 68: 859-865.
  5. Skowron B, Baranowska A, Dobrek L, et al. Urinary neutrophil gelatinase-associated lipocalin, kidney injury molecule-1, uromodulin, and cystatin C concentrations in an experimental rat model of ascending acute kidney injury induced by pyelonephritis. J Physiol Pharmacol 2018; 69: 625-637.
  6. Song S, Tan J, Miao Y, Li M, Zhang Q. Crosstalk of autophagy and apoptosis: Involvement of the dual role of autophagy under ER stress. J Cell Physiol 2017; 232: 2977-2984.
  7. Taniguchi M, Yoshida H. Endoplasmic reticulum stress in kidney function and disease. Curr Opin Nephrol Hypertens 2015; 24: 345-350.
  8. El Karoui K, viau A, Dellis O, et al. Endoplasmic reticulum stress drives proteinuria-induced kidney lesions via lipocalin 2. Nat Commun 2016; 7: 10330. doi: 10.1038/ncomms10330
  9. Fu XO, Du Y, Hou L. Changes of neutrophil gelatinase associated lipocalin after endoplasmic reticulum stress by thapsigargin in renal tubular epithelial cells. Int J Pediatr 2017; 44: 352-355.
  10. Huttl M, Markova I, Miklankova D, et al. Metabolic cardio- and reno-protective effects of empagliflozin in a prediabetic rat model. J Physiol Pharmacol 2020; 71: 635-645.
  11. Wu X, He Y, Jing Y, Li K, Zhang J. Albumin overload induces apoptosis in renal tubular epithelial cells through a CHOP-dependent pathway. OMICS 2010; 14: 61-73.
  12. Lippi G, Meschi T, Nouvenne A, Mattiuzzi C, Borghi L. Neutrophil gelatinase-associated lipocalin in cancer. Adv Clin Chem 2014; 64: 179-219.
  13. Mammen C, Al Abbas A, Skippen P, Nadel H, Levine D, Collet JP, Matsell DG. Long-term risk of CKD in children surviving episodes of acute kidney injury in the intensive care unit: a prospective cohort study. Am J Kidney Dis 2012; 59: 523-530.
  14. Shemin D, Dworkin LD. Neutrophil gelatinase-associated lipocalin (NGAL) as a biomarker for early acute kidney injury. Crit Care Clin 2011; 27: 379-389.
  15. Shalaby M, Khathlan N, Safder O, et al. Outcome of acute kidney injury in pediatric patients admitted to the intensive care unit. Clin Nephrol 2014; 82: 379-386.
  16. Hui Z, Yi ZW, Xiao ZH. The relationship between indexes related to acute renal injury in sepsis. J Clin Pediatr 2015; 33: 1021-1026.
  17. Kari JA, Shalaby MA, Sofyani K, et al. Urinary neutrophil gelatinase-associated lipocalin (NGAL) and serum cystatin C measurements for early diagnosis of acute kidney injury in children admitted to PICU. World J Pediatr 2018; 14: 134-142.
  18. Afify MF, Maher SE, Ibrahim NM, El-Hamied WM. Serum neutrophil gelatinase-associated lipocalin in infants and children with sepsis-related conditions with or without acute renal dysfunction. Clin Med Insights Pediatr 2016; 10: 85-89.
  19. Qiu S, Chen X, Pang Y, Zhang Z. Lipocalin-2 protects against renal ischemia/reperfusion injury in mice through autophagy activation mediated by HIF1α and NF-κB crosstalk. Biomed Pharmacother 2018; 108: 244-253.
  20. Zhang YL, Qiao SK, Wang RY, Guo XN. NGAL attenuates renal ischemia/reperfusion injury through autophagy activation and apoptosis inhibition in rats. Chem Biol Interact 2018; 289: 40-46.
  21. Packiam M, Wu H, Veit SJ, Mavrogiorgos N, Jerse AE, Ingalls RR. Protective role of Toll-like receptor 4 in experimental gonococcal infection of female mice. Mucosal Immunol 2012; 5: 19-29.
  22. Shen J, Chen X, Hendershot L, Prywes R. ER stress regulation of ATF6 localization by dissociation of BiP/GRP78 binding and unmasking of Golgi localization signals. Dev Cell 2002; 3: 99-111.
  23. Gupta S, Li S, Abedin MJ, et al. Prevention of acute kidney injury by tauroursodeoxycholic acid in rat and cell culture models. PLoS One 2012; 7: e48950. doi: 10.1371/journal.pone.0048950
  24. El Mokhtar MA, Seddik MI, Osman A, et al. Hepatitis E virus mediates renal injury via the interaction between the immune cells and renal epithelium. Vaccines (Basel) 2020; 8: 454. doi: 10.3390/vaccines8030454
R e c e i v e d : March 14, 2021
A c c e p t e d : April 30, 2021
Author’s address: Dr. Yue Du, Department of Pediatrics, Shengjing Hospital of China Medical University, No. 36 of Sanhao street, Heping District, Shenyang 110004 China. e-mail: drduyue24@163.com